Introduction

Osmanthus fragrans is a well-known fragrant woody plant with a long history of cultivation in China. Its flesh flowers have extremely strong and unique aroma, containing more than 70 floral volatiles mainly including terpenes, aromatics, esters, etc. (Cao et al. 2009; Xin et al. 2013; Fu et al. 2019; Zou et al. 2019). It is found that there is an obvious circadian rhythm in the synthesis and release of floral volatiles from O. fragrans. Zheng et al. (2017) examined the circadian rhythm of the emission and accumulation of terpene compounds in O. fragrans flowers, and suggested that the expression of genes involved in the synthesis of these compounds is also affected by circadian rhythm. The expression of alcohol acyltransferase (AAT) gene involved in the synthesis of ester compounds also shows circadian rhythm in O. fragrans flowers (Liu et al. 2016). These results indicated that the release and synthesis of floral volatiles in O. fragrans are generally regulated by circadian rhythm, but the molecular mechanism of this phenomenon is still unclear.

Previous studies have shown that MYB, especially the CIRCADIA CLOCK ASSOCIATED 1 (CCA1) subclass of R1-MYB transcription factor, is an important transcription factor regulating circadian rhythm. R1-MYB is an MYB transcription factor containing one R conserved domain. There are 49 and 84 gene members of R1-MYB in Arabidopsis thaliana and rice respectively (Katiyar et al. 2012). Compared with R2R3-MYB transcription factor, little is known about the function of R1-MYB transcription factor. Baranowskij et al. (2010) firstly found that only one R conserved domain in R1-MYB from potato can also play the role of transcriptional activation, which is different from other MYB transcription factors in DNA binding activity. CCA1 from A. thaliana is also R1-MYB type transcription factors that could bind to light-responsive promoters and act as a special activator to transmit photosensitive pigmentation-related signals and regulate circadian rhythm (Wang et al. 1997). Constitutive expression of CCA1 gene in plants results in elongation of cotyledon hypocotyl and lag of flowering time (Wang and Tobin 1998). Therefore, R1-MYB transcription factor plays an important role in regulating circadian rhythm, while no findings about R1-MYB transcription factor in O. fragrans have been reported.

In this study, we cloned a R1-MYB transcription factor named OfMYBR1 from O. fragrans. To gain an insight into the function of OfMYBR1, we applied sequence alignment, protein structure and gene expression pattern analysis, as well as subcellular localization to the OfMYBR1 gene. The hypothesis to be tested was whether R1-MYB transcription factor could regulate the synthesis of the flower fragrance needs further study. The present work would be helpful for understanding of the molecular mechanism that regulates the synthesis of flower fragrance in O. fragrans.

Materials and Methods

Plant materials

In this experiment, all the samples were harvested from the adult tree of O. fragrans ‘Liuye Jingui’ (about 50 years old) in Huazhong Agricultural University (Wuhan, China). Drawing upon the studies by and Zeng et al. (2016), we separately collected the petals (also known as corolla lobes) at four stages: tight bud stage (S1), initial flowering stage (S2), full flowering stage (S3) and late flowering stage (S4). Flowers at the full flowering stage were divided into three parts: petals (P), stamens (S) and the remaining pedicels and pistils (PP). The young leaves (YL) of the current year’s branches were collected in May. The sampling time for circadian rhythm analysis was 6:00–24:00 from the initial to the full flowering stage, once every six hours, and samples for other analysis were collected between 7:00 and 9:00.

Isolation of OfMYBR1 gene and bioinformatics analysis

Total RNA was isolated using TRIzol reagent by the manufacturer’s instructions (CoWin Biotech Co., Ltd., Beijing, China). The full-length of OfMYBR1 gene sequence was obtained via the SMARTER^TM RACE method drawing upon the study by Zeng et al. (2015). The primers for 5’- and 3’- RACE-PCR (Table 1) were based on transcript-derived fragment from cDNA-AFLP (Zeng et al. 2019).

The DNAMAN 6.0 software (Lynnon Biosoft, USA) was used for sequence splicing and multiple sequence alignment. The OfMYBR1 open reading frame (ORF) was predicted by the NCBI ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi). The construction of the phylogenetic tree was based on the default parameters of neighbor-joining computational method by the MEGA 6.1 software. The protein structure and subcellular localization were performed according to Expash website (http://www.expasy.org/tools/) and WoLf PSORT software (http://www.genscript.com/psort/wolf_psort.html).

Real-time PCR analysis

The first-stranded cDNA was synthesized using RevertAid^TM First Strand cDNA Synthesis Kit, following the manufacturer’s instructions (Fermentas, Thermo Fisher Scientific Inc., USA). Then, the qRT-PCR analysis was carried out according to the study by Zeng et al. (2015), on an Applied Biosystems 7500 Fast Real Time PCR platform (Applied Biosystems Life Technologies). The qRT-PCR primers based on the OfMYBR1 gene full length cDNA sequence are listed in Table 1. Using β-actin as the endogenous control gene for data normalization, relative transcript levels were calculated by using the 2^−ΔΔCt method with three biological replicates and each reaction carried out in triplicate.

Subcellular localization of OfMYBR1 gene

The upstream and downstream primers containing restriction sites of XbaI and PstI were used for OfMYBR1 gene full-length cloning (see Table 1). The PCR product of OfMYBR1 full-length was digested with XbaI and PstI. The restriction enzyme-generated inserts were cloned into the Super-1300::GFP binary vector with the XbaI-PstI restriction sites to create Super-1300::OfMYBR1:GFP via T4 DNA ligase (Fermentas, Thermo Fisher Scientific Inc., USA). The correct plasmid was transformed into Agrobacterium tumefaciens strain EHA105.

The transient genetic transformation was applied as described in the study by Zeng et al. (2015). About 35-day-old greenhouse-grown Nicotiana benthamiana seedlings were infiltrated with the A. tumefaciens strain EHA105, harboring the Super-1300::OfMYBR1:GFP and pCAMBIA 2300::p19 (1:1 pair-wise matching). N. benthamiana leaves infiltrated with the Super-1300::GFP and pCAMBIA 2300::p19 Agrobacterium cultures mixed in a 1:1 ratio were used as control. The processed leaves were cultured for 48–54 h in greenhouse, and then the location of fluorescence was detected by laser confocal microscopy.

Statistical analysis

Three biological replications of each sample were performed. The differentiation of gene expression level at different flowering period and in different tissues was performed with one-way ANOVA followed by comparison of means with LSD test (P < 0.05), using SPSS 19.0 software.

Results

Sequence characterization of OfMYBR1 gene in O. fragrans

Table 1: Primers used for gene cloning and expression analysis

Name of primers	Sequence of primers (5’–3’)
RACE PCR
OfMYBR1-3’-1	AAGAACACCACGATCCCTACACC
OfMYBR1-3’-2	ACACGTACACCCACACAGGTTGCAA
OfMYBR1-5’-1	TTGGGTGGTATGATTTTTCTTGATGC
OfMYBR1-5’-2	ATTTTTGAAGATGGGGGAGGTGGAA
Cloning the full-length ORF
OfMYBR1-FL-F	GGCCTCTAAACCTTATATGCGCC
OfMYBR1-FL-R	ttattcccatcaagaaacactaacc
Real-time PCR
OfMYBR1-F	CAAGAACACCACGATCCCTACA
OfMYBR1-R	TAACCATGCTATCTCCACTACCG
Actin-F	ATTATTTCCTTGCTCATACGGTCAG
Actin-R	ATTAGTCCTCTTCCAGCCTTCTTTG
Constructing the subcellular localization vector
OfMYBR1-Y-F	GCTCTAGAATGCGCCAAAACTCCATTAATT
OfMYBR1-Y-R	AACTGCAGGAAACACTAACCATGCTATCTCCAC

Fig. 1: Nucleotide and amino acid sequence of OfMYBR1

The OfMYBR1 ORF sequence was 915 bp, encoding 304 amino acids (Fig. 1). The molecular formula of its encoded protein was C₁₄₆₆H₂₃₂₂N₄₄₀O₄₅₁S₉, with molecular weight 33.70 kDa and theoretical isoelectric point (pI) 9.98. There were 26 negative charge amino acid residues (Asp + Glu) and 35 positive ones (Arg + Lys) in the OfMYBR1 protein. Protein multi-alignment (Fig. 2) of OfMYBR1 with R1-MYB from other plants revealed that OfMYBR1 contained a conserved MYB-like domain. Phylogenetic analysis (Fig. 3) of the predicted amino acid sequence compared with R1-MYB in other species showed that OfMYBR1 had the closest relationship with Fraxinus velutina FvMybR1 (AGK29591.1), followed by soybean GmMYB1R1 (NP_001304346.2). It was grouped together with potato StMYB1R1 (ABB86258.1), rose RhMYB (ABU53684.1), soybean GmMYB176 (ABH02865.1), At1g19000 (BAH19529.1) and Atlg74840 (BAH56970.1) of A. thaliana belonging to CCA1-like II subclass. Therefore, it is possible to infer that the OfMYBR1 gene in O. fragrans has similar function to those in the CCA1-like II subclass.

Temporal and spatial expression analysis of OfMYBR1 gene in O. fragrans

Fig. 2: Protein multi-alignment of OfMYBR1 with R1-MYB from other plants

The expression levels of OfMYBR1 gene at different flowering stages detected by real-time PCR showed that this gene was continuously expressed during the whole flowering process from tight bud to late flowering stage (Fig. 4). Its expression level was low at the tight bud stage and had no significant change from the initial to late flowering stage. In analyzing the expression levels of the OfMYBR1 gene in different tissues (Fig. 5), the highest expression level was found in petals, followed by young leaves, pedicels and pistils, and the lowest expression level was found in stamens. The detection of OfMYBR1 gene expression levels for three consecutive days and nights showed that the gene expression presented a significant circadian rhythm, showing a gradual increase from 0:00 to 6:00 and a gradual decrease from 12:00 to 18:00 (Fig. 6).

Subcellular location of OfMYBR1 gene

The subcellular localization of OfMYBR1 was predicted by WoLf PSORT software. The result showed that OfMYBR1 protein might be located in the nucleus. We constructed Super-1300::OfMYBR1:GFP fusion vector and carried out transient genetic transformation in N. benthamiana leaves. 48 h after injection, the laser confocal fluorescence microscopy detected that the blank vector could find the fluorescence signal in the whole cell, while fluorescence signal could be found only in the nuclear region by the vector containing OfMYBR1 gene (Fig. 7). These results indicated that OfMYBR1 gene actually plays a role in the nucleus.

Discussion

Circadian rhythms based on an endogenous transcriptional clock are observable biological oscillations that occur with a 24 h periodicity (McClung 2006). Circadian rhythms affect many important physiological processes of plants, such as hypocotyl elongation, leaf movement, stomatal switch and flowering (Greenham and McClung 2015; Han et al. 2016). The synthesis and release of flower fragrance are also influenced by circadian rhythm, which is often expressed in diurnal or nocturnal release patterns (Lerdau and Gray 2003; Martin et al. 2003; van Doorn and Woltering 2008). Our previous studies found out that there are also obvious circadian rhythms in the synthesis and release of floral volatiles in O. fragrans (Liu et al. 2016; Zheng et al. 2017). However, the molecular mechanism of these rhythmic synthesis and release controlled by circadian rhythm remains unclear. In this study, an MYB transcription factor encoding 304 amino acids was cloned from O. fragrans. There was only one conserved MYB-like domain in this predicted protein, which has the typical characteristics of R1-MYB transcription factors, named OfMYBR1. Phylogenetic tree analysis showed that the protein encoded by this gene was clustered into a group of R1-MYB transcription factors from soybean, potato, rose and other plants, and belonged to CCA1-like II subclass. Yan et al. (2011) reveal that R1-MYB transcription factor in rose is highly expressed in aromatic wild-type petals, and its expression changes with the amount of flower fragrance release. These results suggest that OfMYBR1

Fig. 3: Homology tree and phylogenetic tree of OfMYBR1and R1-MYB from other plants. StMYB1R-1: Solanum tuberosum ABB86258.1; RhMYB: Rosa hybrid ABU53684.1; GmMYB176: Glycine max ABH02865.1; At1g19000: Arabidopsis thaliana BAH19529.1; At1g74840: A. thaliana BAH56970.1; GmMYB1R1: G. max NP_001304346.2; FvMybR1: F. velutina AGK29591.1; OsMYBS3: Oryza sativa AAN63154.1; StMYB1: S. tuberosum AAB32591.2; OsMYBS1: O. sativa AAN63152.1; OsMYBS2: O. sativa AAN63153.1; AtCCA1: A. thaliana AAB40525.1; GmMYB177: G. max ABH02866.1

Fig. 4: Relative expression of OfMYBR1 gene at different flowering periods. S1, Tight bud stage; S2, initial flowering stage; S3, full flowering stage; S4, late flowering stage. Identical superscript letters indicate that the difference is not significant, whereas different superscript letters imply a significant difference P<0.05

Fig. 5: Relative expression of OfMYBR1 gene in different tissues. P, Petal; PP, Peduncle and pistil; S, Stamen; YL, Young leaf. Identical superscript letters indicate that the difference is not significant, whereas different superscript letters imply a significant difference. P<0.05

obtained in this study may play a similar role to those of R1-MYB transcription factors in other plants that participate in the regulation of flower fragrance in response to circadian rhythm in O. fragrans.

Further analysis of the spatial and temporal expression pattern of the OfMYBR1 gene showed that this gene had the highest expression level in petals and continuous high expression throughout the flowering process. The OfMYBR1 gene expression levels within a day showed circadian rhythm, increasing from 0:00 to 6:00 and decreasing from 12:00 to 18:00. Flower petals are the main tissues for the synthesis and release of floral volatiles in plants (Dudareva et al. 2013). The synthesis and release of floral volatiles in O. fragrans increase significantly from the initial flowering stage (Zeng et al. 2015). Zheng et al. (2017) have analyzed the circadian rhythm of flower fragrance in O. fragrans and concluded that the volatile and free forms of the main aroma components, such as linalool, ocimene and ionone, increase from 0:00 to 6:00, decrease from 12:00 to 18:00, reach a low from 18:00 to 0:00 and peak from 6:00 to 12:00. The glycosidic form of linalool increases from 6:00 to 12:00 and decreases from 18:00 to 0:00. The structural genes involved in the biosynthetic pathway of these floral volatiles increase from 6:00 to 18:00 in the daytime and decrease from 18:00 to 6:00 in the night. It can be seen that the expression pattern of OfMYBR1 was basically consistent with that of structural genes involved in floral volatiles synthesis and the regulation of floral volatiles synthesis and release. The expression time of OfMYBR1 was earlier than that of structural genes involved in floral volatiles synthesis. Subcellular localization results showed that OfMYBR1 protein played a role in the nucleus. Thus, we hold that the OfMYBR1 gene responding to the circadian rhythm might positively regulate the transcription of structural genes involved in floral volatiles synthesis, and affect flower fragrance synthesis and release during the day.

Conclusion

A R1-MYB transcription factor named OfMYBR1 that may be involved in the regulation of flower fragrance in response to circadian rhythm has been obtained in O. fragrans for the first time. The protein structure, homology comparison, expression pattern and protein subcellular localization of the OfMYBR1 gene have been preliminarily completed, laying a foundation for the further study of the molecular mechanism of circadian rhythm regulating the synthesis and release of flower fragrance in O. fragrans.

Acknowledgments

The research was supported by the National Natural Science Foundation of China (No. 31600569 and No. 31700617), Natural Science Foundation Project of Hubei Province (No. 2017CFB235), Science and Technology research project of Hubei Provincial Department of Education (No. Q20182802), Science and Technology Plan Program of Xianning City (XNKJ-1808) and Hubei Collaborative Innovation Center for the Characteristic Ｒesources Exploitation of Dabie Mountains (2015TD02).

References

Baranowskij N, C Frohberg, S Prat, L Willmitzer (2010). A novel DNA-binding protein with homology to MYB on coproteins containing only one repeat can function as a transcriptional activator. EMBO J 13:5383–5392

Cao H, Z Li, D Shen (2009). GC/MS fingerprint analysis of Osmanthus fragrans Lour. in different varieties. Acta Hortic Sin 36:391–398

Dudareva N, A Klempien, JK Muhlemann, I Kaplan (2013). Biosynthesis, function and metabolic engineering of plant volatile organic compounds. New Phytol 198:16–32

Fu J, D Hou, Y Wang, C Zhang, Z Bao, H Zhao, S Hu (2019). Identification of floral aromatic volatile compounds in 29 cultivars from four groups of Osmanthus fragrans by gas chromatography–mass spectrometry. Hortic Environ Biotechnol 60:611–623

Fig. 6: Circadian change of OfMYBR1 transcript level at different time points of three days

Fig. 7: Fluorescence detection of OfMYBR1 subcellular location (Bar=20 µm)

Greenham K, CR McClung (2015). Integrating circadian dynamics with physiological processes in plants. Natl Rev Genet 16:598–610

Han XF, KL Peng, HX Wu, SS Song, YH Li, YR Zhu, YL Bai, Y Wang (2016). A preliminary study on the mechanism of the effect of serine on the rhythm of photorespiration genes. J Plant Physiol 52:1397–1405

Katiyar A, S Smita, SK Lenka, R Rajwanshi, V Chinnusamy, KC Bansal (2012). Genome-wide classification and expression analysis of MYB transcription factor families in rice and Arabidopsis. BMC Genomics 13; Article 544

Lerdau M, D Gray (2003). Ecology and evolution of light-dependent and light-independent phytogenic volatile organic carbon. New Phytol 157:199–211

Liu C, X Zeng, R Zheng, J Luo, C Wang (2016). Cloning and expression of the alcohol acyltransferase gene from Osmanthus fragrans flowers. J Huazhong Agric Univ 35:36–42

Martin DM, J Gershenzon, J Bohlmann (2003). Induction of volatile terpene biosynthesis and diurnal emission by methyl jasmonate in foliage of norway spruce. Plant Physiol 132:1586–1599

McClung CR (2006). Plant circadian rhythms. Plant Cell 18:792–803

van Doorn WG, EJ Woltering (2008). Physiology and molecular biology of petal senescence. J Exp Bot 59:453–480

Wang ZY, D Kenigsbuch, L Sun, E Harel, MS Ong, EM Tobin (1997). A Myb-related transcription factor is involved in the phytochrome regulation of an Arabidopsis Lhcb gene. Plant Cell 9:491–507

Wang ZY, EM Tobin (1998). Constitutive expression of the CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) gene disrupts circadian rhythms and suppresses its own expression. Cell 93:1207–1217

Xin H, B Wu, H Zhang, C Wang, J Li, B Yang, S Li (2013). Characterization of volatile compounds in flowers from four groups of sweet osmanthus (Osmanthus fragrans) cultivars. Can J Plant Sci 93:923–931

Yan H, H Zhang, Q Wang, H Jian, X Qiu, J Wang, K Tang (2011). Isolation and identification of a putative scent-related gene RhMYB1 from rose. Mol Biol Rep 38:4475–4482

Zeng X, C Liu, R Zheng, X Cai, J Luo, J Zou, C Wang (2015). Emission and accumμlation of monoterpene and the key terpene synthase (TPS) associated with monoterpene biosynthesis in Osmanthus fragrans Lour. Front Plant Sci 6; Article 1232

Zeng X, R Zheng, J Luo, C Wang (2016). Cloning and Characterization of Cinnamate 4-hydroxylase（C4H）Genes from Osmanthus fragrans. Acta Hortic Sin 43:525–537

Zeng X, X Zhang, J Zou, C Wang (2019). cDNA-AFLP analysis of differentially expressed genes during flowering in Osmanthus fragrans. Guihaia 39:940–950

Zheng R, C Liu, Y Wang, J Luo, X Zeng, H Ding, W Xiao, J Gan, C Wang (2017). Expression of MEP pathway genes and non-volatile sequestration are associated with circadian rhythm of dominant terpenoids emission in Osmanthus fragrans Lour. flowers. Front Plant Sci 8; Article 1869

Zou JJ, X Cai, XL Zeng, J Yang, CY Wang (2019). Characterization of aroma-active compounds from sweet osmanthus (Osmanthus fragrans) by SDE and SPME coupled with GC-MS and GC-olfactometry. Intl J Agric Biol 22:277‒282